Novel triplex nucleic acid lateral flow immunoassay for rapid detection of Nipah virus, Middle East respiratory syndrome coronavirus and Reston ebolavirus

Table 2 Details of primers used in the development of triplex NALFIA

Virus	Target gene	Primer			Amplicon length (bp)	Ta	Reference
Virus	Target gene	Sequence 5’-3’		Length	Amplicon length (bp)	Ta	Reference
NiV	N	F	TCAGCAGGAAGGCAAGAGAGTAA	23	100	60 °C	Mungall et al. 2006
NiV	N	R	CCCCTTCATCGATATCTTGATCA	23	100	60 °C	Mungall et al. 2006
REBOV	Vp40	F	CTATGGTTATCACCCAGGATTGTG	24	80	60 °C	Trombley et al. 2010
REBOV	Vp40	R	GTAACTATCCTGCTTGTCCATGTG	24	80	60 °C	Trombley et al. 2010
MERS-CoV	UpE	F	GCAACGCGCGATTCAGTT	18	92	58 °C	Corman et al. 2012
MERS-CoV	UpE	R	GCCTCTACACGGGACCCATA	20	92	58 °C	Corman et al. 2012